Insertion junction: LMJ.RY0402.098274_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.098274
Chromosome:chromosome_12
Location:1213906
Confidence (%):58
Locus systematic id Locus common name Defline Orientation Feature
Cre12.g489500 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCCACCCCAAGCACCACCTGGTGGCGGCC
Internal bar code:CCTGATCACATGGGCTGTCGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:4
LEAP-Seq percent confirming:91.555
LEAP-Seq n confirming:683
LEAP-Seq n nonconfirming:63
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GCTCCAGAAGAAGCGAAATG
Suggested primer 2:ATCATCCTTGCTCCGGTATG