| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098343 |
| Chromosome: | chromosome 3 |
| Location: | 6370252 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194000 | SPL14 | Pre-mRNA splicing factor; (1 of 1) K12819 - pre-mRNA-processing factor SLU7 (SLU7) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGGGCCGCCTGGACTGGATTGATTTAG |
| Internal bar code: | ACGCCACCTGGGGCTACAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 429 |
| LEAP-Seq percent confirming: | 82.6647 |
| LEAP-Seq n confirming: | 3915 |
| LEAP-Seq n nonconfirming: | 821 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGGGCTACAACACGGAC |
| Suggested primer 2: | ACGCTTGCATTGTCTCCTCT |