| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098365 |
| Chromosome: | chromosome 1 |
| Location: | 1455613 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007450 | (1 of 4) K15111 - solute carrier family 25 (mitochondrial S-adenosylmethionine transporter), member 26 (SLC25A26) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATGGCCACTGCGTGCTTGTGGGTTGTCC |
| Internal bar code: | ATGGTCGCGGTAGATGGACGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 99.1304 |
| LEAP-Seq n confirming: | 1482 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCGATGGAGAATGGCAC |
| Suggested primer 2: | CCCTTAATGCGTTTCGTGTT |