| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.098387 |
| Chromosome: | chromosome 11 |
| Location: | 882164 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467654 | (1 of 1) K13117 - ATP-dependent RNA helicase DDX35 [EC:3.6.4.13] (DHX35) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTGCCCCGCAGCTGGGCGGCGGCGTG |
| Internal bar code: | GACGTCGTCATCGATTTTGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 97 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGTCCGTCACAAATCCTC |
| Suggested primer 2: | GATGGGTGTGTTTGAAAGGG |