| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098505 |
| Chromosome: | chromosome 14 |
| Location: | 1820779 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620200 | (1 of 1) IPR011527//IPR021261 - ABC transporter type 1, transmembrane domain // Protein of unknown function DUF2838 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGTTGCATTGTCCACTGATTAACGCGC |
| Internal bar code: | GTCCATAAAGATGCGGGGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 99.0772 |
| LEAP-Seq n confirming: | 7408 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTCGTATGTGTGTCCGC |
| Suggested primer 2: | GGTACTAGTGGAGAGCCCCC |