| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.098554 |
| Chromosome: | chromosome 10 |
| Location: | 6059828 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463300 | (1 of 1) PTHR31515:SF0 - TRANSMEMBRANE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATCAGCCCTGCCTCCCGCCCTCCACCCC |
| Internal bar code: | GGGCTAACTACGGATAGGAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 447 |
| LEAP-Seq percent confirming: | 99.4635 |
| LEAP-Seq n confirming: | 927 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTGTGGGCTGTTATTCA |
| Suggested primer 2: | GGGGTTGCACTCATAATTGG |