Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.098559 |
Chromosome: | chromosome 15 |
Location: | 548642 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g637150 | (1 of 781) IPR000104 - Antifreeze protein, type I | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAATAGCTGCTTGCGGCAGATTCACTAGC |
Internal bar code: | TATGCTGTGGCAGGGCGGCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0 |
LEAP-Seq n confirming: | 0 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTCCATGATATCCCAAA |
Suggested primer 2: | TGGAAATCAACAGGGACACA |