| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.098617 |
| Chromosome: | chromosome 3 |
| Location: | 3601627 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168450 | CCT8 | (1 of 1) K09500 - T-complex protein 1 subunit theta (CCT8); T-complex protein 1, theta subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTGCGAGAAGTACGGGCTGATGGTGGT |
| Internal bar code: | GCATGGCCACACGGCCAGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2002 |
| LEAP-Seq percent confirming: | 57.7273 |
| LEAP-Seq n confirming: | 127 |
| LEAP-Seq n nonconfirming: | 93 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGAGAGTGTGGTCGTGAA |
| Suggested primer 2: | GTAATCAAGACGAAGCGGGA |