Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.098630 |
Chromosome: | chromosome 7 |
Location: | 644576 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g317050 | UBQ6 | Ubiquitin; (1 of 2) IPR000626//IPR001841//IPR019956//IPR029071 - Ubiquitin domain // Zinc finger, RING-type // Ubiquitin // Ubiquitin-related domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGTCGGGTGTCGTTTGGCTCCTCGCGA |
Internal bar code: | GCTTCACTTAGTCTCGGGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 687 |
LEAP-Seq percent confirming: | 80.2806 |
LEAP-Seq n confirming: | 5036 |
LEAP-Seq n nonconfirming: | 1237 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTATCGGAGGACGAACCT |
Suggested primer 2: | CGGTTGAGTTTGGCTGGTAT |