Insertion junction: LMJ.RY0402.098636_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.098636
Chromosome:chromosome_12
Location:6950945
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g560350 CNK2 NimA-related protein kinase sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCTCTCCCCACCACCACCACTACCACCACT
Internal bar code:GCCGTGGAATGTATCTCAATG

Confirmation - LEAP-Seq

LEAP-Seq distance:563
LEAP-Seq percent confirming:99.0389
LEAP-Seq n confirming:4843
LEAP-Seq n nonconfirming:47
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:ATGGCTCTGTGTAAGTGGGG
Suggested primer 2:AGCTCACCTCTGTGCAGGAT