| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.098640 |
| Chromosome: | chromosome 2 |
| Location: | 5181341 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105550 | (1 of 1) IPR000104//IPR003008 - Antifreeze protein, type I // Tubulin/FtsZ, GTPase domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATGGAGGAGGTGGCGCACCTGGTGGTG |
| Internal bar code: | GCACAAGGGTCCCGGAGTACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 892 |
| LEAP-Seq percent confirming: | 99.8123 |
| LEAP-Seq n confirming: | 19144 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTATTTGGTGCAGAACCCG |
| Suggested primer 2: | CGGTACCCTGTACTCGCATT |