Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.098890 |
Chromosome: | chromosome 3 |
Location: | 5343029 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g184100 | (1 of 2) PF08797 - HIRAN domain (HIRAN) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATTTTGTCCAGCCTCGTTCATTACGAT |
Internal bar code: | GTGCTTCCAGTACCAACAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 909 |
LEAP-Seq percent confirming: | 99.7211 |
LEAP-Seq n confirming: | 7865 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGGCAAGTTCAGTCTGC |
Suggested primer 2: | AACCCCTGTCCAGCACTATG |