| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.098911 |
| Chromosome: | chromosome 5 |
| Location: | 1284199 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245150 | (1 of 30) PF13450 - NAD(P)-binding Rossmann-like domain (NAD_binding_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTTATGTGCGCTTTGTACGTGCTCAGT |
| Internal bar code: | GCACAGCCACTATGACGCGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 607 |
| LEAP-Seq percent confirming: | 98.9182 |
| LEAP-Seq n confirming: | 3749 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATGAGCGATACGGTTGGC |
| Suggested primer 2: | TCATGATCACACACACCACG |