| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098938 |
| Chromosome: | chromosome 2 |
| Location: | 1526077 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084400 | P4H9,PFH9,PHX4 | (1 of 8) PTHR10869//PTHR10869:SF71 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED; Prolyl 4-hydroxylase 9 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACATGCACAACAGGTTTTAGAGGCAGGG |
| Internal bar code: | CTTAGAATTCCAGGGTCGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 815 |
| LEAP-Seq percent confirming: | 98.517 |
| LEAP-Seq n confirming: | 4185 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTACGACAAGGTGGGGA |
| Suggested primer 2: | TGACGTCCATTACATTCGGA |