| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098962 |
| Chromosome: | chromosome 5 |
| Location: | 3357333 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240700 | FAP378 | Flagellar Associated Protein 378; (1 of 1) PF00530//PF05572 - Scavenger receptor cysteine-rich domain (SRCR) // Pregnancy-associated plasma protein-A (Peptidase_M43) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGACAAGCGTACGGCGGGTGGATTCGGAC |
| Internal bar code: | ACGCGGAGCCAGACAAGAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 588 |
| LEAP-Seq percent confirming: | 99.0314 |
| LEAP-Seq n confirming: | 11860 |
| LEAP-Seq n nonconfirming: | 116 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGGTGGCTGTACGGAAC |
| Suggested primer 2: | GTCTTCCCACGGTTGAGTGT |