| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.099051 |
| Chromosome: | chromosome 12 |
| Location: | 8527781 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g547700 | TTL14 | (1 of 14) PF03133 - Tubulin-tyrosine ligase family (TTL); Putative tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTCTGCCCCCCTGCCCTCCTGCTGCCC |
| Internal bar code: | TATTCACACTACTGGCCTCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 99.5015 |
| LEAP-Seq n confirming: | 998 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATGCCGTACTTCTGGTC |
| Suggested primer 2: | CAACTTGTGGGGACTAGGGA |