Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.099120 |
Chromosome: | chromosome 7 |
Location: | 4643010 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g344350 | TPP1 | Chloroplast thylakoid processing peptidase; (1 of 1) K03100 - signal peptidase I (lepB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGCATGGGTGCGGGTACGGTGCGGTCAC |
Internal bar code: | CGGGGTGGCGGAGTTAAAATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 660 |
LEAP-Seq percent confirming: | 98.2155 |
LEAP-Seq n confirming: | 2862 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCCCTCTCTGTCCATGT |
Suggested primer 2: | GGTTGTAAGTGCAGGACGGT |