| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099123 |
| Chromosome: | chromosome 2 |
| Location: | 80283 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073750 | KIN9-2,KLP1 | Kinesin motor protein; (1 of 3) K10397 - kinesin family member 6/9 (KIF6_9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCGAGCCCCGATAGCAGCCCAGTGCAG |
| Internal bar code: | GACATGAACGCCAGCATGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 98.8116 |
| LEAP-Seq n confirming: | 2245 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAAAACAACCCTGCTCAC |
| Suggested primer 2: | GTCACAAAAGAGCGCAATCA |