| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099130 |
| Chromosome: | chromosome 12 |
| Location: | 2979493 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g501200 | SKP1,ROC80 | E3 ubiquitin ligase; (1 of 1) K03094 - S-phase kinase-associated protein 1 (SKP1, CBF3D) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCACCACCCATCCCCAATTCCGATCCAC |
| Internal bar code: | GCGGTACTTAAGTGTACGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 526 |
| LEAP-Seq percent confirming: | 98.6813 |
| LEAP-Seq n confirming: | 4490 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTTGCATCTCTGACACG |
| Suggested primer 2: | ACTATGATGCCGGTGTGTCA |