Insertion junction: LMJ.RY0402.099158_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.099158
Chromosome:chromosome_1
Location:2341555
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g012800 FAP230 Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACTTCCCACGATACCGCTACGGGAGCCCTG
Internal bar code:GAGGAGGGGGCCAAGTAGAATT

Confirmation - LEAP-Seq

LEAP-Seq distance:484
LEAP-Seq percent confirming:54.8466
LEAP-Seq n confirming:447
LEAP-Seq n nonconfirming:368
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:CAACGGTGTTGATGTATCGC
Suggested primer 2:CCGACTTTGGGCACACTTAT