Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.099356 |
Chromosome: | chromosome 5 |
Location: | 2775496 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g237000 | MAP1D | Methionine aminopeptidase; (1 of 1) PTHR10804:SF82 - METHIONINE AMINOPEPTIDASE 1D, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAGCACAACACAACGCTGTAGCTGTCAA |
Internal bar code: | GCCTAGTCTGTTCCAGCAATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 773 |
LEAP-Seq percent confirming: | 98.862 |
LEAP-Seq n confirming: | 4083 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCATCCTGATCACCGAGAC |
Suggested primer 2: | TCTCAGGAGCAGAACAGGGT |