| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099395 |
| Chromosome: | chromosome 9 |
| Location: | 7515118 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414050 | Pontin,RVB1,RUVBL1 | Nucleoside-triphosphatase RuvB-like protein; (1 of 1) K04499 - RuvB-like protein 1 (pontin 52) (RUVBL1, RVB1, INO80H) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAATGTAACGAAAGATGACTTGAAGCCA |
| Internal bar code: | CCTCGGTATAGGTACGTGGCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 556 |
| LEAP-Seq percent confirming: | 98.4375 |
| LEAP-Seq n confirming: | 126 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGAGGTACTTGTCGCCGC |
| Suggested primer 2: | CCTCGCCTTGTCTAATCTGC |