| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099425 |
| Chromosome: | chromosome 16 |
| Location: | 2928347 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664000 | HLM25 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase; Histone-lysine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGGCACGGTGGCGTGACGCCACGACGG |
| Internal bar code: | TCGACGATTGAGCGGGGGTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 99.3912 |
| LEAP-Seq n confirming: | 653 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACATTATGATCGAACCCC |
| Suggested primer 2: | GACAAGGAGACGTGAGGAGC |