| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.099448 |
| Chromosome: | chromosome 17 |
| Location: | 3200878 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722100 | SSA3 | cilia-sensing, structure and/or assembly; (1 of 1) PTHR12771:SF2 - ELMO DOMAIN-CONTAINING PROTEIN 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAACTGCAATGTGTGCTGTTGCATGGTG |
| Internal bar code: | CTCGCACTCTGGCAAATAAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 975 |
| LEAP-Seq percent confirming: | 98.8676 |
| LEAP-Seq n confirming: | 1135 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCAGGAGGATGTGGGAGA |
| Suggested primer 2: | GGGCGTTGATTAGATCCAGA |