| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099455 |
| Chromosome: | chromosome 8 |
| Location: | 4376339 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381800 | (1 of 2) 5.3.3.2 - Isopentenyl-diphosphate Delta-isomerase / Methylbutenylpyrophosphate isomerase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCCGCTGTGTCGGTCTACCCAACACA |
| Internal bar code: | GCGTAGGGCGCGACAACAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 38.9772 |
| LEAP-Seq n confirming: | 2599 |
| LEAP-Seq n nonconfirming: | 4069 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGCAAACATAAACCGTG |
| Suggested primer 2: | TCCTCCCATACATACACGCA |