Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.099489 |
Chromosome: | chromosome 16 |
Location: | 3581980 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g682013 | (1 of 2) PTHR30545:SF2 - SUGAR FERMENTATION STIMULATION PROTEIN A | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCAAGATCTGAATCCTCACGTTCTCCAC |
Internal bar code: | CTATATGACATGGACTCCGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 712 |
LEAP-Seq percent confirming: | 95.6958 |
LEAP-Seq n confirming: | 667 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGGTGAGGTGTGGTGTCA |
Suggested primer 2: | TACACGTCAGATGGTCCCAA |