| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099496 |
| Chromosome: | chromosome 1 |
| Location: | 2383137 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g013050 | (1 of 2) IPR006652//IPR011043 - Kelch repeat type 1 // Galactose oxidase/kelch, beta-propeller | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCCGTGTTTTATGTACAGAAGCCGTGTT |
| Internal bar code: | CCCGATGCATATATACGGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 292 |
| LEAP-Seq percent confirming: | 99.7633 |
| LEAP-Seq n confirming: | 3794 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGTCAGCGTGTGTACGTT |
| Suggested primer 2: | GGGTATCGTGGTCACAGCTT |