| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099542 |
| Chromosome: | chromosome 2 |
| Location: | 4164790 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098250 | PPO3 | (1 of 1) PF10615//PF13883 - Protein of unknown function (DUF2470) (DUF2470) // Pyridoxamine 5'-phosphate oxidase (Pyrid_oxidase_2); Pyridoxamine 5'-phosphate oxidase-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATGGCCTTGCCGTCCTGAGAGGCGACG |
| Internal bar code: | CAGCACCGTGTTGGCTCGTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 96.9136 |
| LEAP-Seq n confirming: | 314 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTTCTTCGTCATCTCCAC |
| Suggested primer 2: | ACTTCAAGTGGTTCCGGATG |