Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.099549 |
Chromosome: | chromosome 5 |
Location: | 764808 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g248500 | TRXO,TRXO1,TRX15 | Thioredoxin o, mitochondrial; (1 of 1) PTHR10438//PTHR10438:SF275 - THIOREDOXIN // THIOREDOXIN O1, MITOCHONDRIAL-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTTGGAGGTGGGGGCGTCCCAGTTACAG |
Internal bar code: | CAAGACCTCATGGCAGGCCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 679 |
LEAP-Seq percent confirming: | 99.217 |
LEAP-Seq n confirming: | 12672 |
LEAP-Seq n nonconfirming: | 100 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGATACCACCGTGTAGGCG |
Suggested primer 2: | CACGTGATGACGGAGAAAGA |