Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.099572 |
Chromosome: | chromosome 10 |
Location: | 351596 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g420450 | (1 of 2) PTHR18841:SF0 - PROTEIN C08G5.3, ISOFORM A-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGGGTGGGGCGGGGGGAGTTGCGACTTT |
Internal bar code: | CGGGGGGACCCGGTTGAATCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 631 |
LEAP-Seq percent confirming: | 96.9002 |
LEAP-Seq n confirming: | 5658 |
LEAP-Seq n nonconfirming: | 181 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACAAGAACTGCTACCCCC |
Suggested primer 2: | TGTCCATTGTGTGGATGCTT |