| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099600 |
| Chromosome: | chromosome 6 |
| Location: | 8591722 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308850 | EIF3X | (1 of 1) K03245 - translation initiation factor 3 subunit J (EIF3J); hypothetical eIF3-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACTGGGACGGCTGGTGTGGTCACCCGC |
| Internal bar code: | AACATGCCTCTAGCACATGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 721 |
| LEAP-Seq percent confirming: | 94.0814 |
| LEAP-Seq n confirming: | 763 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTATGAGAGCAGGGAG |
| Suggested primer 2: | AAGCACCCCTGGTAGGAAGT |