Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.099611 |
Chromosome: | chromosome 14 |
Location: | 3938232 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g633000 | ERV1,TOX1,ERV1A | Essential for Respiration and Viability 1; (1 of 2) K17783 - mitochondrial FAD-linked sulfhydryl oxidase [EC:1.8.3.2] (ERV1, GFER, ALR) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGTGTGTGTTCCACACGCGGGGTTGCG |
Internal bar code: | GTTAGAAGTTACATTTGGCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1193 |
LEAP-Seq percent confirming: | 99.7059 |
LEAP-Seq n confirming: | 339 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGTCTCACACAGCGCATT |
Suggested primer 2: | AGTCCACACACACGCATCAT |