| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099621 |
| Chromosome: | chromosome 3 |
| Location: | 4790787 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g178500 | RIB43,RIB43a | (1 of 1) PTHR14517//PTHR14517:SF6 - RIB43A-RELATED // SUBFAMILY NOT NAMED; Flagellar protofilament ribbon protein 43 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGGGTGGAGGTAGAGGAAGCAGAGGCT |
| Internal bar code: | CGCACCATGGATATCGCCAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 981 |
| LEAP-Seq percent confirming: | 99.6454 |
| LEAP-Seq n confirming: | 7869 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCCAAACTGGGTAAAGA |
| Suggested primer 2: | GCAGAAGTTTGACGGAGAGG |