Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.099704 |
Chromosome: | chromosome 9 |
Location: | 834815 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g401800 | (1 of 4) 2.7.10.2//2.7.11.1//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Dual-specificity kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTATATGTTGTGGGATAACGGTTGTGAG |
Internal bar code: | GTCCCATACAGGTGGGGACGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 326 |
LEAP-Seq percent confirming: | 89.4515 |
LEAP-Seq n confirming: | 212 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCCGAGCTATTTCGTAG |
Suggested primer 2: | GAGTGGCTGTCACGTCAAGA |