| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099747 |
| Chromosome: | chromosome 17 |
| Location: | 4646680 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733250 | FKB16D,FKB16-4,FKB7 | (1 of 1) PTHR10516:SF323 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP16-4, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTAATCACATGGTGTTGTATTGCAAGAG |
| Internal bar code: | AAGGTCGCTTGGCCGGGTTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 889 |
| LEAP-Seq percent confirming: | 99.641 |
| LEAP-Seq n confirming: | 5274 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCAGTTCACCCCACCAG |
| Suggested primer 2: | AAGGACAGCGAGCGTACAGT |