| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099815 |
| Chromosome: | chromosome 13 |
| Location: | 1365555 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571650 | RPB10 | (1 of 1) K03007 - DNA-directed RNA polymerases I, II, and III subunit RPABC5 (RPB10, POLR2L); DNA-directed RNA polymerases I/II/III subunit 10 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTCACCGCACGTACGTCATATCCGTACG |
| Internal bar code: | CTGCCGGTCAGGAGAGGGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 99.289 |
| LEAP-Seq n confirming: | 1955 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCCTTGTTCTTATCCAG |
| Suggested primer 2: | GCAGGTGATTGGGAACAAGT |