| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099842 |
| Chromosome: | chromosome 16 |
| Location: | 4279667 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g668100 | SMM48 | (1 of 1) PTHR22809//PTHR22809:SF1 - METHYLTRANSFERASE-RELATED // METHYLTRANSFERASE-LIKE PROTEIN 6; S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTCCTCCCTGCTCAATCTTTTGACCAG |
| Internal bar code: | ATGACCTAAAAAAGAATGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 910 |
| LEAP-Seq percent confirming: | 99.7172 |
| LEAP-Seq n confirming: | 2468 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCAATTGATGTCCCAAT |
| Suggested primer 2: | GTGTTGTCATCCCACTCACG |