| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.099848 |
| Chromosome: | chromosome 3 |
| Location: | 7675723 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203850 | ATS1 | ATP-sulfurylase; (1 of 2) 2.7.7.4 - Sulfate adenylyltransferase / Sulfurylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTGTCAGGACCCGGCAGGACAGCACAG |
| Internal bar code: | TGATCCGATGTAGTGCCGTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 946 |
| LEAP-Seq percent confirming: | 99.5643 |
| LEAP-Seq n confirming: | 1371 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCTTCCTTCCCAATC |
| Suggested primer 2: | CTTCATGAACAAGGCGGAGT |