| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.099988 |
| Chromosome: | chromosome 8 |
| Location: | 2423836 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g371400 | CPL16 | zinc finger family protein; (1 of 1) PTHR22763//PTHR22763:SF34 - RING ZINC FINGER PROTEIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGGCATGCAGACGGCCGTACTCTCGC |
| Internal bar code: | GAGCGATGGACGCGGCTTCCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 848 |
| LEAP-Seq percent confirming: | 95.73 |
| LEAP-Seq n confirming: | 1390 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCGTTACTGGACTCAGCA |
| Suggested primer 2: | AGTGCTCCACCAAACAATCC |