Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.100024 |
Chromosome: | chromosome 6 |
Location: | 7298186 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298650 | HEL30,EIF4A | (1 of 1) PTHR24031//PTHR24031:SF308 - RNA HELICASE // SUBFAMILY NOT NAMED; Eukaryotic initiation factor 4A | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCGGTTTGCAAACGGCAGGAGTTTTGT |
Internal bar code: | AAGATGGATCCTCCAGAAGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 603 |
LEAP-Seq percent confirming: | 91.6204 |
LEAP-Seq n confirming: | 4953 |
LEAP-Seq n nonconfirming: | 453 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCAACTACGACCTGCCCAC |
Suggested primer 2: | CGTTGCTTCCGATTAACGAT |