Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.100033 |
Chromosome: | chromosome 6 |
Location: | 7927555 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g303400 | ADF3,FAP16 | (1 of 1) K18597 - echinoderm microtubule-associated protein-like 5 (EML5); necessary for axonemal severing | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATTGTCGAATGTGGCGCAGCGGTGCCC |
Internal bar code: | TGCCGAGATGCTCGGCTTCTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 771 |
LEAP-Seq percent confirming: | 98.1865 |
LEAP-Seq n confirming: | 379 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGCTTAGTGCTTATCCAGC |
Suggested primer 2: | CACCTCAAGTTCATGAGCGA |