| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100036 |
| Chromosome: | chromosome 15 |
| Location: | 1203662 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g641266 | TPT23,TPT22 | (1 of 4) K15285 - solute carrier family 35, member E3 (SLC35E3); Triose phosphate transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTGCTTTCTCCGGTACAGGGCTGGCA |
| Internal bar code: | GCCTGAAGTAAGCGAGTATAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 191 |
| LEAP-Seq percent confirming: | 97.7627 |
| LEAP-Seq n confirming: | 6904 |
| LEAP-Seq n nonconfirming: | 158 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCTCCACTTTTCTGGTC |
| Suggested primer 2: | GGGTTGGGTACTCGTGAAGA |