| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.100097 |
| Chromosome: | chromosome 9 |
| Location: | 4285082 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394658 | LCI28 | (1 of 1) 1.1.1.21 - Aldehyde reductase / Polyol dehydrogenase (NADP(+)); Low-CO2-induced aldose reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCCCGCGCCCGCATCCAGCCCGCCGTC |
| Internal bar code: | ATACGAAGTGGGGAGCACCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 83.0062 |
| LEAP-Seq n confirming: | 3722 |
| LEAP-Seq n nonconfirming: | 762 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTGACAATGGCGACCTAT |
| Suggested primer 2: | CATGTGGCAGCTGCAGTAGT |