Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.100130 |
Chromosome: | chromosome 6 |
Location: | 252542 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g250750 | (1 of 1) K11842 - ubiquitin carboxyl-terminal hydrolase 12/46 [EC:3.4.19.12] (USP12_46) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCCCGCAGGTCACTACGTCTCCCTCAT |
Internal bar code: | ACAGTGGACGTCATCCGCCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 408 |
LEAP-Seq percent confirming: | 99.6711 |
LEAP-Seq n confirming: | 606 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGTTATTGGTATCTCGGG |
Suggested primer 2: | ACGAAACAGTGGGAAACCTG |