| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100162 |
| Chromosome: | chromosome 9 |
| Location: | 2160644 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393250 | (1 of 5) K14347 - solute carrier family 10 (sodium/bile acid cotransporter), member 7 (SLC10A7, P7); Sodium:bile acid symporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCTCAATGAGCCAAAAGAGGAGACACCG |
| Internal bar code: | ACGCCGATCGGGTGGTGTCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 652 |
| LEAP-Seq percent confirming: | 98.8116 |
| LEAP-Seq n confirming: | 4490 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGAGTAACGAAAGAGCAG |
| Suggested primer 2: | GTTCGACCACCTCATGTCCT |