| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.100170 |
| Chromosome: | chromosome 4 |
| Location: | 1180772 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215650 | (1 of 1) PF08743 - Nse4 C-terminal (Nse4_C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGTGAGTTGCAAGGCTGAAGGCATGAG |
| Internal bar code: | TACCTTGTCCCAAAAATGCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 428 |
| LEAP-Seq percent confirming: | 99.6128 |
| LEAP-Seq n confirming: | 6431 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGCGTCTTACCAAGAAC |
| Suggested primer 2: | TAATGCTACCGAGCCCAATC |