Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.100175 |
Chromosome: | chromosome 16 |
Location: | 1788464 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g655200 | PTB6 | Sodium/phosphate symporter PTB6b; (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACACGGACACCGACGACTGTGTCGTCT |
Internal bar code: | CCGGTTGATGAGTAGCGCTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 791 |
LEAP-Seq percent confirming: | 98.9405 |
LEAP-Seq n confirming: | 4856 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCAAGGCTAGGTTTGAG |
Suggested primer 2: | CACACAGGGGTCTTCCAAGT |