| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100181 |
| Chromosome: | chromosome 7 |
| Location: | 5753318 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352950 | (1 of 1) IPR003395//IPR027417 - RecF/RecN/SMC, N-terminal // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGCAGCACCGCCTGCGCCTCCTCCGCCG |
| Internal bar code: | GGTTGTTGCCACCTACAGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 242 |
| LEAP-Seq percent confirming: | 24.7982 |
| LEAP-Seq n confirming: | 215 |
| LEAP-Seq n nonconfirming: | 652 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACAGCGCATGTTCCAAG |
| Suggested primer 2: | TTGATGACGAGAAGTCGCAC |