| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.100235 |
| Chromosome: | chromosome 10 |
| Location: | 5131969 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456400 | DAT1 | (1 of 1) PTHR11958//PTHR11958:SF63 - SODIUM/DICARBOXYLATE SYMPORTER-RELATED // EXCITATORY AMINO ACID TRANSPORTER 2, ISOFORM C; Dicarboxylate/amino acid cation sodium transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGGTCCAGGAACCAGTCCACTGCCAGG |
| Internal bar code: | GTAGTTGGACGCTTGAGAATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 623 |
| LEAP-Seq percent confirming: | 98.0645 |
| LEAP-Seq n confirming: | 152 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGTGATGGAAGGTGTTT |
| Suggested primer 2: | CTACCGCTACGTCCTCTTCG |