| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.100242 |
| Chromosome: | chromosome 3 |
| Location: | 7555059 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205000 | IDA3 | Inner Arm Adaptor to IFT 3; (1 of 1) PF15669 - Coiled-coil domain-containing protein 24 family (CCDC24) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACAGTCGCACATAGCTTGCGCTTACA |
| Internal bar code: | ATAGTATGAGATTGTCTAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 89.4156 |
| LEAP-Seq n confirming: | 4131 |
| LEAP-Seq n nonconfirming: | 489 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTCTGGAGCGGTACAACC |
| Suggested primer 2: | TGCTGTTTTACTGCCACTGC |